ID: 1028889427_1028889432

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1028889427 1028889432
Species Human (GRCh38) Human (GRCh38)
Location 7:95970449-95970471 7:95970467-95970489
Sequence CCAGAGAGATATATCCGAATCTG ATCTGCACAAAGGGTGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 60} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!