ID: 1029111426_1029111438

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1029111426 1029111438
Species Human (GRCh38) Human (GRCh38)
Location 7:98214734-98214756 7:98214757-98214779
Sequence CCAGCGCAGCCCAGGGCTTCCTG GGGGGCAGCAGGAGTGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 53, 4: 427} {0: 1, 1: 0, 2: 2, 3: 91, 4: 881}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!