ID: 1029111732_1029111746

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1029111732 1029111746
Species Human (GRCh38) Human (GRCh38)
Location 7:98216194-98216216 7:98216246-98216268
Sequence CCGGGCCGGGCCAGCCTCTCGCC TCCATGTACAGGACGGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 303} {0: 1, 1: 0, 2: 1, 3: 6, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!