ID: 1029238832_1029238849

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1029238832 1029238849
Species Human (GRCh38) Human (GRCh38)
Location 7:99144156-99144178 7:99144187-99144209
Sequence CCCCCGCGCCTGCGTGCGTGCGC CACGTACGCTGGGGCGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 92} {0: 1, 1: 0, 2: 1, 3: 9, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!