ID: 1029259772_1029259783

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1029259772 1029259783
Species Human (GRCh38) Human (GRCh38)
Location 7:99293968-99293990 7:99294006-99294028
Sequence CCTGTAAGTGCCTATGTTTCCTT CCTCATTTGCAGGAGGAAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 28, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!