ID: 1029294974_1029294982

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1029294974 1029294982
Species Human (GRCh38) Human (GRCh38)
Location 7:99533282-99533304 7:99533306-99533328
Sequence CCTGCCTTCCAGGAAGGTTGGGG GGGAGTTTTGAGTGGGAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 74, 4: 355} {0: 1, 1: 0, 2: 1, 3: 40, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!