ID: 1029328740_1029328746

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1029328740 1029328746
Species Human (GRCh38) Human (GRCh38)
Location 7:99833253-99833275 7:99833304-99833326
Sequence CCAGTCGGATTAACATCCAGAGG CCTTTTAAGCATTTCGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 30, 2: 56, 3: 66, 4: 73} {0: 2, 1: 8, 2: 1, 3: 13, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!