ID: 1029364579_1029364591

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1029364579 1029364591
Species Human (GRCh38) Human (GRCh38)
Location 7:100108435-100108457 7:100108482-100108504
Sequence CCACCTGGGAGCAGAGGAGGGGC TAGGCGTCCTGATTGTCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 58, 4: 522} {0: 1, 1: 0, 2: 1, 3: 3, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!