ID: 1029405854_1029405860

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1029405854 1029405860
Species Human (GRCh38) Human (GRCh38)
Location 7:100373687-100373709 7:100373726-100373748
Sequence CCCTTGCTGCTGCCGCCAGCATT TACCCAGGACCACCCAGATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 200} {0: 1, 1: 0, 2: 0, 3: 43, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!