ID: 1029436490_1029436495

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1029436490 1029436495
Species Human (GRCh38) Human (GRCh38)
Location 7:100566824-100566846 7:100566853-100566875
Sequence CCCTCTACCTAATTCTCTTACCA TCCTTTCTGCTTAGAGCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 208} {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!