ID: 1029469969_1029469978

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1029469969 1029469978
Species Human (GRCh38) Human (GRCh38)
Location 7:100748167-100748189 7:100748214-100748236
Sequence CCAGAGCCAGCTGTGGCAGTTGA GGGTGAGAGCAGGCCCTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 272} {0: 1, 1: 0, 2: 4, 3: 38, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!