ID: 1029532909_1029532912

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1029532909 1029532912
Species Human (GRCh38) Human (GRCh38)
Location 7:101137247-101137269 7:101137262-101137284
Sequence CCCACAGACAGTGCCGGGTCCCC GGGTCCCCGCTCTGTGACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 107} {0: 1, 1: 0, 2: 5, 3: 36, 4: 389}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!