ID: 1029658353_1029658364

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1029658353 1029658364
Species Human (GRCh38) Human (GRCh38)
Location 7:101942582-101942604 7:101942633-101942655
Sequence CCTCCCTAGCAGCTGAGACCACA TTAAATTATTTGTAGAGACAGGG
Strand - +
Off-target summary No data {0: 37, 1: 718, 2: 3003, 3: 16493, 4: 107243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!