|
Left Crispr |
Right Crispr |
Crispr ID |
1029658354 |
1029658364 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:101942585-101942607
|
7:101942633-101942655
|
Sequence |
CCCTAGCAGCTGAGACCACAGAT |
TTAAATTATTTGTAGAGACAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 7, 2: 206, 3: 2459, 4: 20494} |
{0: 37, 1: 718, 2: 3003, 3: 16493, 4: 107243} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|