ID: 1029676672_1029676676

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1029676672 1029676676
Species Human (GRCh38) Human (GRCh38)
Location 7:102074608-102074630 7:102074623-102074645
Sequence CCAAATTCCCGCCACTCCCACTG TCCCACTGAGTCCTCAGCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 214} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!