ID: 1029679192_1029679195

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1029679192 1029679195
Species Human (GRCh38) Human (GRCh38)
Location 7:102096276-102096298 7:102096291-102096313
Sequence CCCTGACTCTTCTGAACACCCTT ACACCCTTCATTAGTGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 253} {0: 1, 1: 0, 2: 0, 3: 11, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!