ID: 1029695922_1029695927

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1029695922 1029695927
Species Human (GRCh38) Human (GRCh38)
Location 7:102213182-102213204 7:102213202-102213224
Sequence CCACCTCCTTTGGTGGAGATTGT TGTCCCTTGCAGATGGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 166} {0: 1, 1: 0, 2: 0, 3: 21, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!