ID: 1029701839_1029701845

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1029701839 1029701845
Species Human (GRCh38) Human (GRCh38)
Location 7:102252326-102252348 7:102252348-102252370
Sequence CCTCGGCATGGCTCCCCTTCAGC CAGGCTGGCATTCCAAGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 132} {0: 2, 1: 0, 2: 2, 3: 24, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!