ID: 1029703198_1029703206

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1029703198 1029703206
Species Human (GRCh38) Human (GRCh38)
Location 7:102261160-102261182 7:102261204-102261226
Sequence CCTGTCTTTTCCAAGAAGTTCAG AGGGCCCTGGTCGAGCATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 199} {0: 1, 1: 0, 2: 0, 3: 21, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!