ID: 1029714160_1029714173

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1029714160 1029714173
Species Human (GRCh38) Human (GRCh38)
Location 7:102317138-102317160 7:102317173-102317195
Sequence CCCCTTTCTCCTTCCCCCCATGT CATCCCCACCTCAGGGGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 77, 4: 861} {0: 1, 1: 0, 2: 2, 3: 23, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!