ID: 1029731601_1029731612

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1029731601 1029731612
Species Human (GRCh38) Human (GRCh38)
Location 7:102442081-102442103 7:102442121-102442143
Sequence CCCAACACAGAGAACCAGTGATC AAACCTCTGCATAGGCCAGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 7, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!