ID: 1029743682_1029743689

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1029743682 1029743689
Species Human (GRCh38) Human (GRCh38)
Location 7:102505326-102505348 7:102505355-102505377
Sequence CCTGGGAGAAGTGGCCCTGAGGT GCCCGGCCACGTGTGTGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 12, 4: 215} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!