|
Left Crispr |
Right Crispr |
Crispr ID |
1029771059 |
1029771063 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:102654521-102654543
|
7:102654541-102654563
|
Sequence |
CCCTGTCTCTTCTAGAAGCACAA |
CAAAAATGAGCTGGGCGTTCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206} |
{0: 7, 1: 9, 2: 712, 3: 22770, 4: 95694} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|