ID: 1029813171_1029813182

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1029813171 1029813182
Species Human (GRCh38) Human (GRCh38)
Location 7:103069267-103069289 7:103069319-103069341
Sequence CCTGGTTGCCGCCCCATCTGGAA GCAACCCTCGAAGTGTGAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 19, 3: 9, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!