ID: 1029841408_1029841412

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1029841408 1029841412
Species Human (GRCh38) Human (GRCh38)
Location 7:103367604-103367626 7:103367623-103367645
Sequence CCCGATCTAGAGGTAAGAAAACC AACCATTTCATTTTAGGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 211} {0: 1, 1: 0, 2: 3, 3: 44, 4: 450}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!