ID: 1029847864_1029847867

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1029847864 1029847867
Species Human (GRCh38) Human (GRCh38)
Location 7:103431476-103431498 7:103431507-103431529
Sequence CCACAGCTGGCTAATTTTTAAAT ATAGAGAAAGGGTCTCATTATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 14, 3: 79, 4: 467}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!