ID: 1029954316_1029954320

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1029954316 1029954320
Species Human (GRCh38) Human (GRCh38)
Location 7:104621577-104621599 7:104621605-104621627
Sequence CCTTTCCCTCCAGGGAGTTGACA CTTAATCATATTGCCGTCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!