ID: 1029973415_1029973424

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1029973415 1029973424
Species Human (GRCh38) Human (GRCh38)
Location 7:104811455-104811477 7:104811501-104811523
Sequence CCTCCCAAAGTGTTGGGATTGCA CTAAGTGAGATTCCTAATGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!