ID: 1030009392_1030009398

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1030009392 1030009398
Species Human (GRCh38) Human (GRCh38)
Location 7:105151316-105151338 7:105151347-105151369
Sequence CCCTGGGCAAGCTGTTTAAGCTG TTCATTCTCATCTATGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 103, 4: 691} {0: 1, 1: 0, 2: 2, 3: 13, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!