ID: 1030033336_1030033359

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1030033336 1030033359
Species Human (GRCh38) Human (GRCh38)
Location 7:105388531-105388553 7:105388584-105388606
Sequence CCCGGGGGACCAGCCCGCCCGCC GCGGCCGCGGGCGCCCCCGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 247} {0: 1, 1: 0, 2: 3, 3: 20, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!