ID: 1030076718_1030076722

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1030076718 1030076722
Species Human (GRCh38) Human (GRCh38)
Location 7:105743249-105743271 7:105743267-105743289
Sequence CCAAGAATGATTACATATCTGTG CTGTGCCAAGAACTGGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 439} {0: 1, 1: 0, 2: 4, 3: 35, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!