ID: 1030138729_1030138740

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1030138729 1030138740
Species Human (GRCh38) Human (GRCh38)
Location 7:106284643-106284665 7:106284676-106284698
Sequence CCCACTGCGGCGCCTCCTCACCT CCGCCGCCCGCGCCTCCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149} {0: 1, 1: 1, 2: 14, 3: 123, 4: 850}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!