ID: 1030262466_1030262484

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1030262466 1030262484
Species Human (GRCh38) Human (GRCh38)
Location 7:107580208-107580230 7:107580257-107580279
Sequence CCCTGGCTCCCCTCCCCCGCCCA CGGCGGCCGCGGAGCAGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 116, 4: 1166} {0: 1, 1: 0, 2: 4, 3: 48, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!