ID: 1030273080_1030273085

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1030273080 1030273085
Species Human (GRCh38) Human (GRCh38)
Location 7:107690925-107690947 7:107690962-107690984
Sequence CCAGCAGGACACAGTCGAAGAGA TGGGCACAAGAGACAGACTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 52, 4: 480}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!