ID: 1030627365_1030627370

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1030627365 1030627370
Species Human (GRCh38) Human (GRCh38)
Location 7:111858834-111858856 7:111858860-111858882
Sequence CCTTCCTCCATGTATAGACACAT CCCTATTGGTTCTGTTTCTCTGG
Strand - +
Off-target summary No data {0: 27, 1: 376, 2: 1019, 3: 1768, 4: 7763}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!