ID: 1030661475_1030661483

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1030661475 1030661483
Species Human (GRCh38) Human (GRCh38)
Location 7:112223663-112223685 7:112223704-112223726
Sequence CCAAGGCTCCCACAAAGGCGCTT AAAATTTTTTGAGAGAAGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 74, 4: 813}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!