ID: 1030717733_1030717738

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1030717733 1030717738
Species Human (GRCh38) Human (GRCh38)
Location 7:112830071-112830093 7:112830111-112830133
Sequence CCTAGGACTCTCAACTCCCTAGG GAATCACCTGAACTCTGCTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!