ID: 1030820747_1030820754

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1030820747 1030820754
Species Human (GRCh38) Human (GRCh38)
Location 7:114087719-114087741 7:114087747-114087769
Sequence CCGCAACGCGCCCTGACACCCGA GTGTGGACCCTCACTTGCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!