ID: 1031003743_1031003744

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1031003743 1031003744
Species Human (GRCh38) Human (GRCh38)
Location 7:116448166-116448188 7:116448192-116448214
Sequence CCATTAAGCTGCATTATCTCTCT TTTGAAGTTATCTTTTCCAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 53, 4: 452}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!