ID: 1031011051_1031011066

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1031011051 1031011066
Species Human (GRCh38) Human (GRCh38)
Location 7:116525730-116525752 7:116525770-116525792
Sequence CCAACACGTAGCTGCCCTTCAGC GGAGTGCCCTGAGGGTGGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 92} {0: 1, 1: 0, 2: 2, 3: 46, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!