ID: 1031051882_1031051888

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1031051882 1031051888
Species Human (GRCh38) Human (GRCh38)
Location 7:116953440-116953462 7:116953464-116953486
Sequence CCCGGGCCGCGGCGGCGGCGGCG CGCGAGCTGCGCCTCCGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 31, 2: 220, 3: 532, 4: 1486} {0: 1, 1: 0, 2: 1, 3: 8, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!