ID: 1031323434_1031323436 |
View in Genome Browser |
Spacer: -6 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1031323434 | 1031323436 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 7:120362854-120362876 | 7:120362871-120362893 |
Sequence | CCTCTATAGGTTGGATGCAGGGT | CAGGGTGAACAGAACCAGGAAGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 5, 3: 72, 4: 568} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |