ID: 1031325722_1031325728

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1031325722 1031325728
Species Human (GRCh38) Human (GRCh38)
Location 7:120394697-120394719 7:120394733-120394755
Sequence CCTACACCCAGGAATAAGCAAGG CTGTGAGACTAGAAGTAAGATGG
Strand - +
Off-target summary {0: 2, 1: 19, 2: 181, 3: 385, 4: 976} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!