ID: 1031470931_1031470936

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1031470931 1031470936
Species Human (GRCh38) Human (GRCh38)
Location 7:122168548-122168570 7:122168598-122168620
Sequence CCCACACCACATGGAAAGCCAGT TTTGCCAGATTCCAGGAGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!