ID: 1031474446_1031474448 |
View in Genome Browser |
Spacer: 11 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1031474446 | 1031474448 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 7:122205344-122205366 | 7:122205378-122205400 |
Sequence | CCAGTAACAGGCCAAGGTCTGTC | GAGTAGTTATCTGCAGAAGATGG |
Strand | - | + |
Off-target summary | No data | {0: 178, 1: 192, 2: 102, 3: 110, 4: 247} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |