ID: 1031695310_1031695320

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1031695310 1031695320
Species Human (GRCh38) Human (GRCh38)
Location 7:124844448-124844470 7:124844488-124844510
Sequence CCATTGGCACCGGGCGCGGTGGC GCACTTTGGGAGGCCGAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 13, 3: 101, 4: 496} {0: 84291, 1: 218536, 2: 234154, 3: 158283, 4: 172560}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!