ID: 1031919972_1031919975

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1031919972 1031919975
Species Human (GRCh38) Human (GRCh38)
Location 7:127593329-127593351 7:127593344-127593366
Sequence CCTCCTAAGGGCCATAAAAGCTG AAAAGCTGATAGATTTTTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!