ID: 1031949193_1031949194

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1031949193 1031949194
Species Human (GRCh38) Human (GRCh38)
Location 7:127874136-127874158 7:127874173-127874195
Sequence CCACGCAGAAGCATTTAATAGGC GTGTCTCTGCCCCACCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 88} {0: 1, 1: 0, 2: 5, 3: 39, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!