ID: 1031999324_1031999328

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1031999324 1031999328
Species Human (GRCh38) Human (GRCh38)
Location 7:128254531-128254553 7:128254552-128254574
Sequence CCAGAAACGTGATCCAAATATCC CCAACGACCTGGAGAACCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 272} {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!