ID: 1032080734_1032080739

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1032080734 1032080739
Species Human (GRCh38) Human (GRCh38)
Location 7:128857249-128857271 7:128857267-128857289
Sequence CCCATGGCCCCTGGCAACTACCT TACCTCATTGCCATCAAGTACGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 5, 3: 31, 4: 406} {0: 2, 1: 0, 2: 1, 3: 8, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!